Smarcb1^em1Koke
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smarcb1^em1Koke
• Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1; endonuclease-mediated mutation 1, Kornelius Kerl
• MGI ID: MGI:7520876
• Synonyms: Smarcb1^1148del
• Gene: Smarcb1 Location: Chr10:75732603-75757448 bp, - strand Genetic Position: Chr10, 38.61 cM
• Alliance: Smarcb1^em1Koke page

Mutation origin

• Strain of Origin: (C57BL/6J x DBA)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intragenic deletion
• Mutation details: One of coding cDNA C nucleotides at c.1145-1148 (GRCm39:chr10:g.75732893-75732896) was targeted for deletion using a crRNA (targeting GCCAACACTGCCCCAGCC) and an ssODN template (GGCGAATGAGGCGTCTTGCCAACACTGCCCAGCCTGGTGATGAAGACATCCATGCTCGAC) with CRISPR/Cas9 technology. The deletion causes a frameshift just before the stop codon, which replaces the last 3 endogenous codons with 35 non-endogenous codons. (J:337790)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Smarcb1 Mutation: 22 strains or lines available

References

• Original: J:337790 Brugmans AK, et al., A Carboxy-terminal Smarcb1 Point Mutation Induces Hydrocephalus Formation and Affects AP-1 and Neuronal Signalling Pathways in Mice. Cell Mol Neurobiol. 2023 May 23
• All: 1 reference(s)