About   Help   FAQ
Cacng3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cacng3em1(IMPC)J
Name: calcium channel, voltage-dependent, gamma subunit 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7520872
Gene: Cacng3  Location: Chr7:122270967-122368616 bp, + strand  Genetic Position: Chr7, 66.81 cM, cytoband F3
Alliance: Cacng3em1(IMPC)J page
IMPC: Cacng3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGTAGTGATCAACATC and GCAGCAGGTCCTCCACAACC, which resulted in a 289 bp deletion beginning at Chromosome 7 position 122,671,671 bp and ending after 122,671,959 bp (GRCm38/mm10). This mutation deletes 289 bp from ENSMUSE00001291041 (exon 1) including the start site and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cacng3 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory