About   Help   FAQ
Cacna1dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cacna1dem1(IMPC)J
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7520869
Gene: Cacna1d  Location: Chr14:29761898-30213113 bp, - strand  Genetic Position: Chr14, 18.43 cM, cytoband B
Alliance: Cacna1dem1(IMPC)J page
IMPC: Cacna1d gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GATGGCATCAGGATCTAGCA and TCTGTTATCATGTCTGTGCG that targeted exon(s) ENSMUSE00000619086.2. This resulted in deletion(s) of 455 bp (location: Chr14:29918475-29918929; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cacna1d Mutation:  118 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory