Cacna1dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cacna1dem1(IMPC)J |
| Name: |
calcium channel, voltage-dependent, L type, alpha 1D subunit; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7520869 |
| Gene: |
Cacna1d Location: Chr14:29761898-30213113 bp, - strand Genetic Position: Chr14, 18.43 cM, cytoband B
|
| Alliance: |
Cacna1dem1(IMPC)J page
|
| IMPC: |
Cacna1d gene page |
|
| Strain of Origin: |
Not Applicable
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATCAGGATCTAGCA and TCTGTTATCATGTCTGTGCG, which resulted in a 455 bp deletion beginning at Chromosome 14 position 30,196,518 bp and ending after 30,196,972 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000619086 (exon 4) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|