About   Help   FAQ
Cacna1dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cacna1dem1(IMPC)J
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7520869
Gene: Cacna1d  Location: Chr14:29761898-30213113 bp, - strand  Genetic Position: Chr14, 18.43 cM, cytoband B
Alliance: Cacna1dem1(IMPC)J page
IMPC: Cacna1d gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATCAGGATCTAGCA and TCTGTTATCATGTCTGTGCG, which resulted in a 455 bp deletion beginning at Chromosome 14 position 30,196,518 bp and ending after 30,196,972 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000619086 (exon 4) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cacna1d Mutation:  117 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory