About   Help   FAQ
Wdr24em1Jiguo
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr24em1Jiguo
Name: WD repeat domain 24; endonuclease-mediated mutation 1, Jianping Guo
MGI ID: MGI:7520408
Synonyms: Wdr24S155A
Gene: Wdr24  Location: Chr17:26042601-26047704 bp, + strand  Genetic Position: Chr17, 12.92 cM
Alliance: Wdr24em1Jiguo page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsSerine codon 155 (TCT) in exon 1 was changed to alanine (GCT) (p.S155A) using an sgRNA (targeting GTGCTTTGACCTCCGAAGGAAGG and GACTCTGTCAGCACCTTCTCTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the affected residue in the encoded peptide from phosphorylatable to a phosphoblocker. (J:338167)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Wdr24 Mutation:  46 strains or lines available
References
Original:  J:338167 Dai X, et al., AMPK-dependent phosphorylation of the GATOR2 component WDR24 suppresses glucose-mediated mTORC1 activation. Nat Metab. 2023 Feb;5(2):265-276
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory