Slc25a32em3Liliu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc25a32em3Liliu |
| Name: |
solute carrier family 25, member 32; endonuclease-mediated mutation 3, Li Liu |
| MGI ID: |
MGI:7520351 |
| Synonyms: |
Slc25a32- |
| Gene: |
Slc25a32 Location: Chr15:38954626-38976111 bp, - strand Genetic Position: Chr15, 15.39 cM
|
| Alliance: |
Slc25a32em3Liliu page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence, Null/knockout) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Tyrosine codon 174 (TAT) in exon 4 was changed to cysteine (TGT) (c.521A>G, p.Y174C) using an sgRNA (targeting TATAAATATGAAGGTGTGCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). This allele also contains an unintended c.552G>A (AAG to AAA, p.K184K) mutation in the last base of exon 4 that changes splice donor site G-GT to A-GT. This affects splicing, resulting in transcripts that skip exon 4 or exons 3 and 4.
(J:338257)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Slc25a32 Mutation: |
20 strains or lines available
|
|
| Original: |
J:338257 Peng MZ, et al., Mitochondrial FAD shortage in SLC25A32 deficiency affects folate-mediated one-carbon metabolism. Cell Mol Life Sci. 2022 Jun 21;79(7):375 |
| All: |
1 reference(s) |
|