About   Help   FAQ
Slc25a32em2Liliu
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc25a32em2Liliu
Name: solute carrier family 25, member 32; endonuclease-mediated mutation 2, Li Liu
MGI ID: MGI:7520349
Synonyms: Slc25a32K235R
Gene: Slc25a32  Location: Chr15:38954626-38976111 bp, - strand  Genetic Position: Chr15, 15.39 cM
Alliance: Slc25a32em2Liliu page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation details

Lysine codon 235 (AAA) in exon 6 was changed to arginine (AGA) (c.704A>G, p.K235R) using an sgRNA (targeting ATACGGGTATGTTGCTGCTACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). (J:338257)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 15 assay results
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slc25a32 Mutation:  22 strains or lines available
References
Original:  J:338257 Peng MZ, et al., Mitochondrial FAD shortage in SLC25A32 deficiency affects folate-mediated one-carbon metabolism. Cell Mol Life Sci. 2022 Jun 21;79(7):375
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory