Tmem161b^em2Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem161b^em2Jgg
• Name: transmembrane protein 161B; endonuclease-mediated mutation 2, Joseph G Gleeson
• MGI ID: MGI:7520066
• Synonyms: W317R-KI
• Gene: Tmem161b Location: Chr13:84370415-84444085 bp, + strand Genetic Position: Chr13, 44.2 cM
• Alliance: Tmem161b^em2Jgg page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Hypomorph)
• Mutation: Nucleotide substitutions
• Mutation details: Tryptophan codon 317 (TGG) in exon 10 was changed to arginine (CGT) (c.949_951delTGGinsCGT, p.W317R) using an sgRNA (targeting CATTTGATACTCTTCGACTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.949C>T:p.W317R mutation associated with polymicrogyria (PMG). (J:338312)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem161b Mutation: 55 strains or lines available

References

• Original: J:338312 Wang L, et al., TMEM161B modulates radial glial scaffolding in neocortical development. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2209983120
• All: 1 reference(s)