Dcst2em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dcst2em1(IMPC)Hmgu |
| Name: |
DC-STAMP domain containing 2; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH |
| MGI ID: |
MGI:7519111 |
| Gene: |
Dcst2 Location: Chr3:89269282-89284856 bp, + strand Genetic Position: Chr3, 39.09 cM
|
| Alliance: |
Dcst2em1(IMPC)Hmgu page
|
| IMPC: |
Dcst2 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AGGGTCAACCAAGGGCGAGA and GCTAACGGTTCTTGAGAGTG that targeted exon(s) ENSMUSE00001376411.2 ENSMUSE00001377352.2 ENSMUSE00001379121.2 ENSMUSE00001381889.2 ENSMUSE00001382093.2. This resulted in deletion(s) of 4532 bp (location: Chr3:89275264-89279795; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|