About   Help   FAQ
Il1r1em1Qizh
Endonuclease-mediated Allele Detail
Summary
Symbol: Il1r1em1Qizh
Name: interleukin 1 receptor, type I; endonuclease-mediated mutation 1, Qing Zhou
MGI ID: MGI:7519061
Synonyms: Il1r1R134E
Gene: Il1r1  Location: Chr1:40264240-40356417 bp, + strand  Genetic Position: Chr1, 18.81 cM
Alliance: Il1r1em1Qizh page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 134 (CGG) in exon 4 was changed to glutamic acid (GAA) (p.R134E) using an sgRNA (targeting CACAGGCCACCTTCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.K131E mutation found in a patient suffering from erosive arthritis and osteomyelitis. (J:338375)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Il1r1 Mutation:  37 strains or lines available
References
Original:  J:338375 Wang Y, et al., Identification of an IL-1 receptor mutation driving autoinflammation directs IL-1-targeted drug design. Immunity. 2023 Jul 11;56(7):1485-1501.e7
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory