About   Help   FAQ
Zbtb8osem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zbtb8osem1(IMPC)J
Name: zinc finger and BTB domain containing 8 opposite strand; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7519009
Gene: Zbtb8os  Location: Chr4:129229325-129243664 bp, + strand  Genetic Position: Chr4, 63.26 cM, cytoband D2.3
Alliance: Zbtb8osem1(IMPC)J page
IMPC: Zbtb8os gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTACAAACATCCTATAT and GTTGAGTTATATAATTTACA, which resulted in a 671 bp deletion beginning at Chromosome 4 position 129,341,314 bp and ending after 129,341,984 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001231489 and ENSMUSE00001243208 (exons 3 and 4) and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zbtb8os Mutation:  48 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory