About   Help   FAQ
Slc6a1em1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc6a1em1Lutzy
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1; endonuclease-mediated mutation 1, Cathy LUtz
MGI ID: MGI:7518260
Gene: Slc6a1  Location: Chr6:114259735-114294491 bp, + strand  Genetic Position: Chr6, 53.05 cM, cytoband E3
Alliance: Slc6a1em1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Null/knockout)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc6a1 Mutation:  48 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory