Slc6a1^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc6a1^em1Lutzy
• Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1; endonuclease-mediated mutation 1, Cathy LUtz
• MGI ID: MGI:7518260
• Gene: Slc6a1 Location: Chr6:114259735-114294491 bp, + strand Genetic Position: Chr6, 53.05 cM, cytoband E3
• Alliance: Slc6a1^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc6a1 Mutation: 51 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)