Calm1^em1Dmy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Calm1^em1Dmy
• Name: calmodulin 1; endonuclease-mediated mutation 1, Dong-Min Yin
• MGI ID: MGI:7518245
• Synonyms: 3KR-Cam1
• Gene: Calm1 Location: Chr12:100165694-100176073 bp, + strand Genetic Position: Chr12, 50.43 cM
• Alliance: Calm1^em1Dmy page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutations: Insertion, Intragenic deletion
• Mutation details: Lysine codons 22, 95 and 116 (AAA, AAG, AAG) were changed to arginine (AGG) (p.K22R, p.K95R, p.K116R) using sgRNAs (targeting TTCTCCCTATTCGATAAAGATGG and TTAGAACTGAGTGAGCACCAGGG) and a dsDNA donor vector with CRISPR/Cas9 technology. The donor sequence replaces exon 3 from bp 29 and the first 28 bp of intron 3 and contains the following: 35 bp left homology arm (last 7 bp intron 2 + first 28 bp exon 3), 387 bp coding sequence for AA 22-149 + TGA stop codon with the three lysine-to-arginine mutations and alternative codons for most or all of the codons for the non-mutated amino-acids, bovine growth hormone gene poly(A) signal sequences, and 35 bp right homology arm (intron 3 from bp 29). The mutations block the affected residues in the encoded peptide from being acetylated. (J:338763)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Calm1 Mutation: 21 strains or lines available

References

• Original: J:338763 Zhang HL, et al., Acetylation of calmodulin regulates synaptic plasticity and fear learning. J Biol Chem. 2021 Sep;297(3):101034
• All: 1 reference(s)