About   Help   FAQ
Tcf7em1Aben
Endonuclease-mediated Allele Detail
Summary
Symbol: Tcf7em1Aben
Name: transcription factor 7, T cell specific; endonuclease-mediated mutation 1, Albert Bendelac
MGI ID: MGI:7518204
Synonyms: Tcf7mCherry
Gene: Tcf7  Location: Chr11:52143198-52174158 bp, - strand  Genetic Position: Chr11, 31.86 cM
Alliance: Tcf7em1Aben page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, Reporter)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used a guide crRNA [CGACCTGAGAATGTTGGTGC] to insert an internal ribosomal entry site (IRES)/mCherry red fluorescent /3XFLAG epitope fusion gene into the 3' UTR of the gene. Tcf transcript Tcf-201 (ENSMUST00000086844.10) was used as reference for the exon number and guide sequences. (J:307783)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tcf7 Mutation:  29 strains or lines available
References
Original:  J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2)
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory