Gata3^em1Aben
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gata3^em1Aben
• Name: GATA binding protein 3; endonuclease-mediated mutation 1, Albert Bendelac
• MGI ID: MGI:7518200
• Synonyms: Gata3^Citrine
• Gene: Gata3 Location: Chr2:9861889-9894845 bp, - strand Genetic Position: Chr2, 6.69 cM
• Alliance: Gata3^em1Aben page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing used a guide crRNA [GGAGGAACTCTTCGCACACT] to insert an internal ribosomal entry site (IRES)/citrine yellow fluorescent sequence into the 3' UTR of the gene. Gata3 transcript Gata3-201 (ENSMUST00000102976.4) was used as reference for for the exon number and guide sequences (J:307783)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gata3 Mutation: 31 strains or lines available

References

• Original: J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2)
• All: 1 reference(s)