Nwd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nwd1em1(IMPC)J |
| Name: |
NACHT and WD repeat domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7515017 |
| Gene: |
Nwd1 Location: Chr8:73372865-73443508 bp, + strand Genetic Position: Chr8, 35.08 cM
|
| Alliance: |
Nwd1em1(IMPC)J page
|
| IMPC: |
Nwd1 gene page |
|
| Strain of Origin: |
Not Applicable
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGTAATAGTCACACCATC and ACTTGCGTTTGAGATCACAG, which resulted in a 546 bp deletion beginning at Chromosome 8 position 72,662,018 bp and ending after 72,662,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000981978 (exon 4) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 8 amino acids later. There is a 4 bp insertion at the deletion site (TTGA).
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|