Dimt1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dimt1em1(IMPC)J |
| Name: |
DIM1 rRNA methyltransferase and ribosome maturation factor; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7515012 |
| Gene: |
Dimt1 Location: Chr13:107083635-107096732 bp, + strand Genetic Position: Chr13, 58.06 cM, cytoband D1
|
| Alliance: |
Dimt1em1(IMPC)J page
|
| IMPC: |
Dimt1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCAATCGGTTCTACTGGT and TTCTGGCAAGAAACACAGGG, which resulted in a 1536 bp deletion beginning at Chromosome 13 position 106,948,451 bp and ending after 106,949,986 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120073, ENSMUSE00000120072, ENSMUSE00000120070, ENSMUSE00000311714 (exons 3,4,5 and 6) and 1243 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 20 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|