About   Help   FAQ
Ace2em1Asuh
Endonuclease-mediated Allele Detail
Summary
Symbol: Ace2em1Asuh
Name: angiotensin converting enzyme 2; endonuclease-mediated mutation 1, Andreas Suhrbier
MGI ID: MGI:7514877
Synonyms: mACE2-
Gene: Ace2  Location: ChrX:162922338-162971414 bp, + strand  Genetic Position: ChrX, 76.12 cM, cytoband F5
Alliance: Ace2em1Asuh page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome targeting used guide RNAs (GGATGGGATCTTGGCGCACG and AGGTTGAGAATGGTGCTCGC) to delete the entire locus. Ace2 transcript Ace2-202 was used as reference for the exon number and the guide sequences. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ace2 Mutation:  72 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory