Ace2^em1Asuh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ace2^em1Asuh
• Name: angiotensin converting enzyme 2; endonuclease-mediated mutation 1, Andreas Suhrbier
• MGI ID: MGI:7514877
• Synonyms: mACE2^-
• Gene: Ace2 Location: ChrX:162922338-162971414 bp, + strand Genetic Position: ChrX, 76.12 cM, cytoband F5
• Alliance: Ace2^em1Asuh page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome targeting used guide RNAs (GGATGGGATCTTGGCGCACG and AGGTTGAGAATGGTGCTCGC) to delete the entire locus. Ace2 transcript Ace2-202 was used as reference for the exon number and the guide sequences. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ace2 Mutation: 54 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)