About   Help   FAQ
Gng12em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gng12em1(IMPC)Tcp
Name: guanine nucleotide binding protein (G protein), gamma 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7512907
Gene: Gng12  Location: Chr6:66873381-66998334 bp, + strand  Genetic Position: Chr6, 30.68 cM
Alliance: Gng12em1(IMPC)Tcp page
IMPC: Gng12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTTGGTGCTTGCCGTCTTGC (within ENSMUSE00000256838) and CGGAGCGACCCCCTGCTGAT(within exon ENSMUSE00001368854). This resulted in a 1769bp deletion of Chr6 from 66992743 to 66994511 with insertion of A and a T>C at 66992738 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gng12 Mutation:  48 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory