About   Help   FAQ
Pahem1Auma
Endonuclease-mediated Allele Detail
Summary
Symbol: Pahem1Auma
Name: phenylalanine hydroxylase; endonuclease-mediated mutation 1, Aurora Martinez
MGI ID: MGI:7512826
Synonyms: Pah-R261Q
Gene: Pah  Location: Chr10:87357657-87419998 bp, + strand  Genetic Position: Chr10, 43.64 cM, cytoband C2-D1
Alliance: Pahem1Auma page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 261 (CGA) in exon 7 was changed to glutamine (CAA) (c.782 G>A, p.R261Q) using an sgRNA (targeting AGTGGAAGACTCGGAAGGCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with phenylketonuria (PKU). (J:305268)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pah Mutation:  53 strains or lines available
References
Original:  J:305268 Aubi O, et al., The Pah-R261Q mouse reveals oxidative stress associated with amyloid-like hepatic aggregation of mutant phenylalanine hydroxylase. Nat Commun. 2021 Apr 6;12(1):2073
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory