Rnd3^em1Nses
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnd3^em1Nses
• Name: Rho family GTPase 3; endonuclease-mediated mutation 1, Senad Sestan
• MGI ID: MGI:7511886
• Synonyms: Rnd3^fl
• Gene: Rnd3 Location: Chr2:51020451-51039123 bp, - strand Genetic Position: Chr2, 29.63 cM
• Alliance: Rnd3^em1Nses page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Guide RNAs (ATCAGAGAGCTCCTATGCAT and TTTCCTCCAAAAAACGAACG) were designed to insert loxP sites flanking exon 3. (J:338359)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rnd3 Mutation: 28 strains or lines available

References

• Original: J:338359 Kaur N, et al., Neural Stem Cells Direct Axon Guidance via Their Radial Fiber Scaffold. Neuron. 2020 Sep 23;107(6):1197-1211.e9
• All: 1 reference(s)