About   Help   FAQ
Gpr182em1Thln
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr182em1Thln
Name: G protein-coupled receptor 182; endonuclease-mediated mutation 1, Marcus Thelen
MGI ID: MGI:7511838
Synonyms: GPR182mCherry
Gene: Gpr182  Location: Chr10:127585471-127587667 bp, - strand  Genetic Position: Chr10, 75.07 cM
Alliance: Gpr182em1Thln page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout, Reporter)
Mutation:    Insertion
 
Mutation detailsGuide RNAs (gctgggtatgactgacatgaggg and tgcaattctgtagccagctaagg) were designed to replace the single coding exon with a red fluorescent protein (mCherry) sequence. (J:338343)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gpr182 Mutation:  23 strains or lines available
References
Original:  J:338343 Melgrati S, et al., Atlas of the anatomical localization of atypical chemokine receptors in healthy mice. PLoS Biol. 2023 May;21(5):e3002111
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory