Gpr182^em1Thln
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr182^em1Thln
• Name: G protein-coupled receptor 182; endonuclease-mediated mutation 1, Marcus Thelen
• MGI ID: MGI:7511838
• Synonyms: GPR182^mCherry
• Gene: Gpr182 Location: Chr10:127585471-127587667 bp, - strand Genetic Position: Chr10, 75.07 cM
• Alliance: Gpr182^em1Thln page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout, Reporter)
• Mutation: Insertion
• Mutation details: Guide RNAs (gctgggtatgactgacatgaggg and tgcaattctgtagccagctaagg) were designed to replace the single coding exon with a red fluorescent protein (mCherry) sequence. (J:338343)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gpr182 Mutation: 23 strains or lines available

References

• Original: J:338343 Melgrati S, et al., Atlas of the anatomical localization of atypical chemokine receptors in healthy mice. PLoS Biol. 2023 May;21(5):e3002111
• All: 2 reference(s)