About   Help   FAQ
Creb5em1Abl
Endonuclease-mediated Allele Detail
Summary
Symbol: Creb5em1Abl
Name: cAMP responsive element binding protein 5; endonuclease-mediated mutation 1, Andrew Lassar
MGI ID: MGI:7511680
Synonyms: Creb5flox9
Gene: Creb5  Location: Chr6:53264255-53677361 bp, + strand  Genetic Position: Chr6, 25.9 cM
Alliance: Creb5em1Abl page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsGuide RNAs (cccccactaggattctccaaatg and cctcatctataattagggaccaa) are designed to insert loxP sites flanking exon 9 of the gene (ENSEMBL Transcript: ENSMUST00000203487.3 Creb5-202). (J:331689)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Creb5 Mutation:  19 strains or lines available
References
Original:  J:331689 Zhang CH, et al., Creb5 coordinates synovial joint formation with the genesis of articular cartilage. Nat Commun. 2022 Nov 26;13(1):7295
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory