Creb5^em1Alb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Creb5^em1Alb
• Name: cAMP responsive element binding protein 5; endonuclease-mediated mutation 1, Arthur L Beaudet
• MGI ID: MGI:7511680
• Synonyms: Creb5^flox9
• Gene: Creb5 Location: Chr6:53264255-53677361 bp, + strand Genetic Position: Chr6, 25.9 cM
• Alliance: Creb5^em1Alb page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Guide RNAs (cccccactaggattctccaaatg and cctcatctataattagggaccaa) are designed to insert loxP sites flanking exon 9 of the gene (ENSEMBL Transcript: ENSMUST00000203487.3 Creb5-202). (J:331689)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Creb5 Mutation: 18 strains or lines available

References

• Original: J:331689 Zhang CH, et al., Creb5 coordinates synovial joint formation with the genesis of articular cartilage. Nat Commun. 2022 Nov 26;13(1):7295
• All: 1 reference(s)