Aicda^em1Jaych
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aicda^em1Jaych
• Name: activation-induced cytidine deaminase; endonuclease-mediated mutation 1, Jayanta Chaudhuri
• MGI ID: MGI:7511620
• Synonyms: Aicda^G133V, Aicda^GV
• Gene: Aicda Location: Chr6:122530768-122541139 bp, + strand Genetic Position: Chr6, 57.65 cM, cytoband F2
• Alliance: Aicda^em1Jaych page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Glutamine codon 133 (GGG) was changed to valine (GTA) (p.G133V) using an sgRNA (targeting CTGCGGAGACTGCACCGCGC) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation associated with HIGM2 (hyper-IgM syndrome type 2). (J:305843)

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Aicda Mutation: 55 strains or lines available

References

• Original: J:305843 Yewdell WT, et al., A Hyper-IgM Syndrome Mutation in Activation-Induced Cytidine Deaminase Disrupts G-Quadruplex Binding and Genome-wide Chromatin Localization. Immunity. 2020 Nov 17;53(5):952-970.e11
• All: 1 reference(s)