About   Help   FAQ
Rapsnem1Line
Endonuclease-mediated Allele Detail
Summary
Symbol: Rapsnem1Line
Name: receptor-associated protein of the synapse; endonuclease-mediated mutation 1, Lin Mei
MGI ID: MGI:7511609
Synonyms: Rapsn R164H
Gene: Rapsn  Location: Chr2:90865965-90876074 bp, + strand  Genetic Position: Chr2, 50.44 cM
Alliance: Rapsnem1Line page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 164 (CGT) in exon 2 was changed to histidine (CAC) (p.R164H) using an sgRNA (targeting TGCCCAGGCTGCAGCAGACA) and an ssODN template with CRISPR/Cas9 technology. This mutation in the fifth TRP motif inhibits Rapsn LLPS (liquid-liquid phase separation). (J:307397)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rapsn Mutation:  31 strains or lines available
References
Original:  J:307397 Xing G, et al., Membraneless condensates by Rapsn phase separation as a platform for neuromuscular junction formation. Neuron. 2021 Jun 16;109(12):1963-1978.e5
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory