Plaat1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plaat1^em1(IMPC)J
• Name: phospholipase A and acyltransferase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7510126
• Gene: Plaat1 Location: Chr16:29028447-29049283 bp, + strand Genetic Position: Chr16, 20.01 cM, cytoband B2
• Alliance: Plaat1^em1(IMPC)J page
• IMPC: Plaat1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGTTCCACATTATCAGA and GGACGTCTTGAAATCTGGGC, which resulted in a 3242 bp deletion beginning at Chromosome 16 position 29,217,529 bp and ending after 29,220,770 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294575 and ENSMUSE00000266795 (exons 2 and 3) and 2837 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plaat1 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)