About   Help   FAQ
Plaat1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Plaat1em1(IMPC)J
Name: phospholipase A and acyltransferase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7510126
Gene: Plaat1  Location: Chr16:29028447-29049283 bp, + strand  Genetic Position: Chr16, 20.01 cM, cytoband B2
Alliance: Plaat1em1(IMPC)J page
IMPC: Plaat1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGTTCCACATTATCAGA and GGACGTCTTGAAATCTGGGC, which resulted in a 3242 bp deletion beginning at Chromosome 16 position 29,217,529 bp and ending after 29,220,770 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294575 and ENSMUSE00000266795 (exons 2 and 3) and 2837 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Plaat1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory