Sall1em1Glass
Endonuclease-mediated Allele Detail
|
Symbol: |
Sall1em1Glass |
Name: |
spalt like transcription factor 1; endonuclease-mediated mutation 1, Christopher K Glass |
MGI ID: |
MGI:7509096 |
Synonyms: |
EKO |
Gene: |
Sall1 Location: Chr8:89753867-89770790 bp, - strand Genetic Position: Chr8, 43.51 cM, cytoband D
|
Alliance: |
Sall1em1Glass page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: CRISPR/cas9 endonuclease-mediated genome editing used sgRNA (protospacers: GAATGACCCTGGCAATCATG, TCCATAAG ATAGCTTAGGGA, CTTGACAG ACATTACACAGG, CTAGAATCGGCTTTGGTGCT) to delete a region spanning 13 kb.
(J:337600)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Sall1 Mutation: |
77 strains or lines available
|
|
Original: |
J:337600 Fixsen BR, et al., SALL1 enforces microglia-specific DNA binding and function of SMADs to establish microglia identity. Nat Immunol. 2023 Jul;24(7):1188-1199 |
All: |
1 reference(s) |
|