About   Help   FAQ
Sall1em1Glass
Endonuclease-mediated Allele Detail
Summary
Symbol: Sall1em1Glass
Name: spalt like transcription factor 1; endonuclease-mediated mutation 1, Christopher K Glass
MGI ID: MGI:7509096
Synonyms: EKO
Gene: Sall1  Location: Chr8:89753867-89770790 bp, - strand  Genetic Position: Chr8, 43.51 cM, cytoband D
Alliance: Sall1em1Glass page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing used sgRNA (protospacers: GAATGACCCTGGCAATCATG, TCCATAAG ATAGCTTAGGGA, CTTGACAG ACATTACACAGG, CTAGAATCGGCTTTGGTGCT) to delete a region spanning 13 kb. (J:337600)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sall1 Mutation:  78 strains or lines available
References
Original:  J:337600 Fixsen BR, et al., SALL1 enforces microglia-specific DNA binding and function of SMADs to establish microglia identity. Nat Immunol. 2023 Jul;24(7):1188-1199
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory