About   Help   FAQ
Carhsp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Carhsp1em1(IMPC)J
Name: calcium regulated heat stable protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7507543
Gene: Carhsp1  Location: Chr16:8476444-8490017 bp, - strand  Genetic Position: Chr16, 4.26 cM
Alliance: Carhsp1em1(IMPC)J page
IMPC: Carhsp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATGTCCACCACAGATGGT and ACAGAGCTTGAGACTCCTAG, which resulted in a 1108 bp deletion beginning at Chromosome 16 position 8,663,387 bp and ending after 8,664,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129745 and ENSMUSE00000563877 (exons 2 and 3) and 797 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted result in a null allele. There is a 9 bp insertion (TCACTCACA)at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Carhsp1 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory