Stpg3^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stpg3^em1(IMPC)Mbp
• Name: sperm tail PG rich repeat containing 3; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7507209
• Gene: Stpg3 Location: Chr2:25102219-25104649 bp, - strand Genetic Position: Chr2, 17.07 cM, cytoband A3
• Alliance: Stpg3^em1(IMPC)Mbp page
• IMPC: Stpg3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GCCTTGGTAAGCCTCAAGAG and TGGGAGAGCCCCTCCTGATC that targeted exon(s) ENSMUSE00000338654.5 ENSMUSE00000379597.3 ENSMUSE00000417937.3 ENSMUSE00000699045.2 ENSMUSE00000699050.2 ENSMUSE00001213969.2 ENSMUSE00001241151.2 ENSMUSE00001274607.2 ENSMUSE00001286577.2 ENSMUSE00001683966.1. This resulted in deletion(s) of 4 bp (location: Chr2:25104805-25104808; GRCm39), 1714 bp (location: Chr2:25103016-25104729; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Stpg3 Mutation: 16 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)