G6pc1^em1Jyc
Endonuclease-mediated Allele Detail

Summary

• Symbol: G6pc1^em1Jyc
• Name: glucose-6-phosphatase catalytic subunit 1; endonuclease-mediated mutation 1, Janice Yang Chou
• MGI ID: MGI:7506302
• Synonyms: G6pc-R83C
• Gene: G6pc1 Location: Chr11:101258542-101268729 bp, + strand Genetic Position: Chr11, 64.83 cM
• Alliance: G6pc1^em1Jyc page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 83 (CGC) in exon 2 was changed to cysteine (TGC) (p.R83C) using an sgRNA (targeting GTTTGGACAACGCCCGTATTG) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation found in glycogen storage disease type Ia (GSD-Ia) patients. (J:320697)

Disease models

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any G6pc1 Mutation: 18 strains or lines available

References

• Original: J:320697 Arnaoutova I, et al., Correction of metabolic abnormalities in a mouse model of glycogen storage disease type Ia by CRISPR/Cas9-based gene editing. Mol Ther. 2021 Apr 7;29(4):1602-1610
• All: 1 reference(s)