Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Zhiyong Liu
• MGI ID: MGI:7505567
• Synonyms: Rosa26-CAG-Loxp-stop-Loxp-Insm1*3HA-P2A-tdTomato, Rosa26^Insm1
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu} page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Epitope tag, Inserted expressed sequence, Reporter)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu} expresses 1 gene
  Knock-in expresses:
  

  Organism	Expressed Gene	Note
  mouse	Insm1 (MGI:1859980)

• Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu} expression driven by 1 gene
  Knock-in expression driven by:
  

  Organism	Driver Gene	Note
  chicken	CAG

• Mutation details: Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged Insm1 gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream. (J:336865)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 945 strains or lines available

References

• Original: J:336865 Li S, et al., Epistatic genetic interactions between Insm1 and Ikzf2 during cochlear outer hair cell development. Cell Rep. 2023 May 30;42(5):112504
• All: 1 reference(s)