About   Help   FAQ
Gt(ROSA)26Sorem3(CAG-Insm1,-tdTomato)Zyliu
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem3(CAG-Insm1,-tdTomato)Zyliu
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Zhiyong Liu
MGI ID: MGI:7505567
Synonyms: Rosa26-CAG-Loxp-stop-Loxp-Insm1*3HA-P2A-tdTomato, Rosa26Insm1
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem3(CAG-Insm1,-tdTomato)Zyliu page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Epitope tag, Inserted expressed sequence, Reporter)
Mutation:    Insertion
 
Gt(ROSA)26Sorem3(CAG-Insm1,-tdTomato)Zyliu expresses 1 gene
 
Gt(ROSA)26Sorem3(CAG-Insm1,-tdTomato)Zyliu expression driven by 1 gene
 
Mutation detailsPlasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged Insm1 gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream. (J:336865)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1060 strains or lines available
References
Original:  J:336865 Li S, et al., Epistatic genetic interactions between Insm1 and Ikzf2 during cochlear outer hair cell development. Cell Rep. 2023 May 30;42(5):112504
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory