Tbx2^em2Zyliu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbx2^em2Zyliu
• Name: T-box 2; endonuclease-mediated mutation 2, Zhiyong Liu
• MGI ID: MGI:7495854
• Synonyms: Tbx2^-
• Gene: Tbx2 Location: Chr11:85723441-85732774 bp, + strand Genetic Position: Chr11, 51.34 cM
• Alliance: Tbx2^em2Zyliu page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing is used to delete the entire coding region. sgRNA-1 (TGACCCGCCGTAAGGGCCTG) and sgRNA-2 (AGGCTCCGAGGCGCCGACGT) targeted upstream of exon 1 and downstream of exon 7. (J:337553)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tbx2 Mutation: 29 strains or lines available

References

• Original: J:337553 Bi Z, et al., Development and transdifferentiation into inner hair cells require Tbx2. Natl Sci Rev. 2022 Dec;9(12):nwac156
• All: 1 reference(s)