About   Help   FAQ
Pcbp1em8Salr
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcbp1em8Salr
Name: poly(rC) binding protein 1; endonuclease-mediated mutation 8, Stephen A Liebhaber
MGI ID: MGI:7495618
Synonyms: Pcbp1fl
Gene: Pcbp1  Location: Chr6:86501462-86503171 bp, - strand  Genetic Position: Chr6, 37.72 cM, cytoband D1
Alliance: Pcbp1em8Salr page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 gene editing uses two guide RNAs to insert loxP sites around the promoter and full coding sequence. The 5'sgRNA (GGACAACGTGGGCAAAACTG) is designed to target chromosome 6 (Chr 6) coordinates 86,526,355 to 86,526,374 (Mus musculus genomic assembly mm10), and the 3'sgRNA (AGCACCCCATACTTAAAACA) targeted to Chr 6, positions 86,524,407 to 86,524,426. (J:337554)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pcbp1 Mutation:  32 strains or lines available
References
Original:  J:337554 Ji X, et al., RNA-Binding Proteins PCBP1 and PCBP2 Are Critical Determinants of Murine Erythropoiesis. Mol Cell Biol. 2021 Aug 24;41(9):e0066820
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory