Pcbp1^em8Salr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcbp1^em8Salr
• Name: poly(rC) binding protein 1; endonuclease-mediated mutation 8, Stephen A Liebhaber
• MGI ID: MGI:7495618
• Synonyms: Pcbp1^fl
• Gene: Pcbp1 Location: Chr6:86501462-86503171 bp, - strand Genetic Position: Chr6, 37.72 cM, cytoband D1
• Alliance: Pcbp1^em8Salr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 gene editing uses two guide RNAs to insert loxP sites around the promoter and full coding sequence. The 5'sgRNA (GGACAACGTGGGCAAAACTG) is designed to target chromosome 6 (Chr 6) coordinates 86,526,355 to 86,526,374 (Mus musculus genomic assembly mm10), and the 3'sgRNA (AGCACCCCATACTTAAAACA) targeted to Chr 6, positions 86,524,407 to 86,524,426. (J:337554)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcbp1 Mutation: 32 strains or lines available

References

• Original: J:337554 Ji X, et al., RNA-Binding Proteins PCBP1 and PCBP2 Are Critical Determinants of Murine Erythropoiesis. Mol Cell Biol. 2021 Aug 24;41(9):e0066820
• All: 1 reference(s)