About   Help   FAQ
Runx1em1Salr
Endonuclease-mediated Allele Detail
Summary
Symbol: Runx1em1Salr
Name: runt related transcription factor 1; endonuclease-mediated mutation 1, Stephen A Liebhaber
MGI ID: MGI:7495608
Synonyms: Runx1deltaE6
Gene: Runx1  Location: Chr16:92398354-92622962 bp, - strand  Genetic Position: Chr16, 53.7 cM
Alliance: Runx1em1Salr page
Mutation
origin
Strain of Origin:  (C57BL/6J x SJL/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Modified isoform(s))
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing is used to delete exon 6. The intron 5 sgRNA (Runx1E6_gRNA.254, GGGCACCGAGTCCCAGACTG) was designed to target chromosome 16 (Chr 16) coordinates 92644590 to 92644609 (Mus musculus genomic assembly mm10) and the intron 6 sgRNA (Runx1E6_gRNA.121, GAAACCCCGCAGCATCAGCT) targeted to Chr 16, positions 92644031 to 92644050. (J:265272)
Expression
In Mice Carrying this Mutation: 14 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Runx1 Mutation:  34 strains or lines available
References
Original:  J:265272 Ghanem LR, et al., Poly(C)-Binding Protein Pcbp2 Enables Differentiation of Definitive Erythropoiesis by Directing Functional Splicing of the Runx1 Transcript. Mol Cell Biol. 2018 Aug 15;38(16)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory