Runx1^em1Salr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Runx1^em1Salr
• Name: runt related transcription factor 1; endonuclease-mediated mutation 1, Stephen A Liebhaber
• MGI ID: MGI:7495608
• Synonyms: Runx1deltaE6
• Gene: Runx1 Location: Chr16:92398354-92622962 bp, - strand Genetic Position: Chr16, 53.7 cM
• Alliance: Runx1^em1Salr page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing is used to delete exon 6. The intron 5 sgRNA (Runx1E6_gRNA.254, GGGCACCGAGTCCCAGACTG) was designed to target chromosome 16 (Chr 16) coordinates 92644590 to 92644609 (Mus musculus genomic assembly mm10) and the intron 6 sgRNA (Runx1E6_gRNA.121, GAAACCCCGCAGCATCAGCT) targeted to Chr 16, positions 92644031 to 92644050. (J:265272)

Expression

In Mice Carrying this Mutation:

14 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Runx1 Mutation: 35 strains or lines available

References

• Original: J:265272 Ghanem LR, et al., Poly(C)-Binding Protein Pcbp2 Enables Differentiation of Definitive Erythropoiesis by Directing Functional Splicing of the Runx1 Transcript. Mol Cell Biol. 2018 Aug 15;38(16)
• All: 1 reference(s)