Rela^em1Tes
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rela^em1Tes
• Name: Rela proto-oncogene, NFKB subunit; endonuclease-mediated mutation 1, Lino Tessarollo
• MGI ID: MGI:7493516
• Synonyms: mEGFP-RelA
• Gene: Rela Location: Chr19:5687511-5698158 bp, + strand Genetic Position: Chr19, 4.34 cM, cytoband B1-3
• Alliance: Rela^em1Tes page

Mutation origin

• Strain of Origin: B6D2F1

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Reporter)
• Mutation: Insertion
• Mutation details:

  Using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (CGTGGGCTCAGCTGCGACCC) was used to insert a cassette containing an initial loxP site, the Rela proto-oncogene, NFKB subunit (Rela) promoter sequence, and an enhanced green fluorescent protein (EGFP) sequence, immediately after the start codon of the Rela proto-oncogene, as well as a second loxP in the first intron of Rela gene on chromosome 19. As the loxP flanked region also contains the Rela promoter sequence, this allows for generation of a Cre-inducible knock-out. (J:101977, J:336990)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rela Mutation: 28 strains or lines available

References

• Original: J:336990 Martin EW, et al., Assaying Homodimers of NF-kappaB in Live Single Cells. Front Immunol. 2019;10:2609
• All: 4 reference(s)