Cul3^em1Limi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cul3^em1Limi
• Name: cullin 3; endonuclease-mediated mutation 1, Lilia M Iakoucheva
• MGI ID: MGI:7491948
• Synonyms: Cul3^-
• Gene: Cul3 Location: Chr1:80242640-80318197 bp, - strand Genetic Position: Chr1, 41.24 cM, cytoband C4
• Alliance: Cul3^em1Limi page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: A single nucleotide (A) was inserted (after GRCm39:g.80264764A) into exon 6 using an sgRNAs (targeting GGATTAATGAGGAAATAGAG) and an ssODN template with CRISPR/Cas9 technology. This frameshift mutation was generated next to the site of the human p.E246* mutation associated with autism spectrum disorder (ASD). (J:332937)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	11 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cul3 Mutation: 50 strains or lines available

References

• Original: J:332937 Amar M, et al., Autism-linked Cullin3 germline haploinsufficiency impacts cytoskeletal dynamics and cortical neurogenesis through RhoA signaling. Mol Psychiatry. 2021 Mar 16
• All: 1 reference(s)