About   Help   FAQ
Inhaem1Crah
Endonuclease-mediated Allele Detail
Summary
Symbol: Inhaem1Crah
Name: inhibin alpha; endonuclease-mediated mutation 1, Craig A Harrison
MGI ID: MGI:7491749
Synonyms: InhaR233A
Gene: Inha  Location: Chr1:75483872-75487010 bp, + strand  Genetic Position: Chr1, 39.16 cM, cytoband C5
Alliance: Inhaem1Crah page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 233 (CGT) in exon 2 was changed to alanine (GCG) (ENSMUST00000037330.5:c.697_699delinsGCG p.R233A) using an sgRNA (targeting GCACGGAGGGAGTTGAACGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R232A that blocks the inhibin function of the encoded peptide but preserves activin A/B production. (J:324311)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Inha Mutation:  9 strains or lines available
References
Original:  J:324311 Walton KL, et al., Inhibin Inactivation in Female Mice Leads to Elevated FSH Levels, Ovarian Overstimulation, and Pregnancy Loss. Endocrinology. 2022 Apr 1;163(4)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory