About   Help   FAQ
Fer1l6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fer1l6em1(IMPC)J
Name: fer-1 like family member 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7491739
Gene: Fer1l6  Location: Chr15:58381897-58536936 bp, + strand  Genetic Position: Chr15, 24.88 cM
Alliance: Fer1l6em1(IMPC)J page
IMPC: Fer1l6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCACCAGAGATGTAGAG and AGGAGAAGAGCGTAGCCACT, which resulted in a 635 bp deletion beginning at Chromosome 15 position 58,549,969 bp and ending after 58,550,603 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851953 and ENSMUSE00000870098 (exons 4-5) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 27 amino acids later. There is a single bp insertion (T) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fer1l6 Mutation:  89 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory