About   Help   FAQ
Trim42em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trim42em1(IMPC)J
Name: tripartite motif-containing 42; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7491697
Gene: Trim42  Location: Chr9:97231615-97252011 bp, - strand  Genetic Position: Chr9, 51.06 cM, cytoband E4
Alliance: Trim42em1(IMPC)J page
IMPC: Trim42 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGAGAAATCTAGACACT and GGTGATAAACGGTTCCTGCA, which resulted in a 948 bp deletion beginning at Chromosome 9 position 97,365,460 bp and ending after 97,366,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219798 (exon 2) and 250 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Trim42 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory