Trim42em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Trim42em1(IMPC)J |
| Name: |
tripartite motif-containing 42; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7491697 |
| Gene: |
Trim42 Location: Chr9:97231615-97252011 bp, - strand Genetic Position: Chr9, 51.06 cM, cytoband E4
|
| Alliance: |
Trim42em1(IMPC)J page
|
| IMPC: |
Trim42 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGAGAAATCTAGACACT and GGTGATAAACGGTTCCTGCA, which resulted in a 948 bp deletion beginning at Chromosome 9 position 97,365,460 bp and ending after 97,366,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219798 (exon 2) and 250 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|