About   Help   FAQ
Tomtem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tomtem1(IMPC)Tcp
Name: transmembrane O-methyltransferase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7490176
Gene: Tomt  Location: Chr7:101549010-101555572 bp, - strand  Genetic Position: Chr7, 54.68 cM
Alliance: Tomtem1(IMPC)Tcp page
IMPC: Tomt gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCCAATGGTCAAGCGTGGTG and AGCCACATGGGCCCTGTTAA within exon ENSMUSE00000671717. This resulted in a 15bp deletion of Chr7 from 101551254 to 101551268 (GRCm39) and a 1bp deletion of Chr 7 at 101551228, introducing a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tomt Mutation:  15 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory