Pdia2^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdia2^em1(IMPC)Mbp
• Name: protein disulfide isomerase associated 2; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7490175
• Gene: Pdia2 Location: Chr17:26414973-26418061 bp, - strand Genetic Position: Chr17, 13.07 cM
• Alliance: Pdia2^em1(IMPC)Mbp page
• IMPC: Pdia2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CTGCCTATCTCCGCCCCTGA and CTTGAGGGCCGCATAGCCAC that targeted exon(s) ENSMUSE00000139232.3 ENSMUSE00000399961.4 ENSMUSE00000701389.2 ENSMUSE00000709085.2 ENSMUSE00000711849.2 ENSMUSE00000721453.2 ENSMUSE00001227964.2 ENSMUSE00001231281.2 ENSMUSE00001248486.2 ENSMUSE00001258017.2 ENSMUSE00001261718.2 ENSMUSE00001278381.2 ENSMUSE00001294547.2 ENSMUSE00001312068.2. This resulted in deletion(s) of 3289 bp (location: Chr17:26414832-26418120; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pdia2 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)