About   Help   FAQ
Jade3em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Jade3em1(IMPC)Tcp
Name: jade family PHD finger 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7490169
Gene: Jade3  Location: ChrX:20291927-20386178 bp, + strand  Genetic Position: ChrX, 15.9 cM
Alliance: Jade3em1(IMPC)Tcp page
IMPC: Jade3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATTTCCAGGCCGTGCTCAA and AAGCTTCTGTGCCCGTAGGC targeting within exon ENSMUSE00000326487. This resulted in a 161bp deletion of ChrX from 0377309 to 20377469 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Jade3 Mutation:  17 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory