Sting1^em3Zjc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sting1^em3Zjc
• Name: stimulator of interferon response cGAMP interactor 1; endonuclease-mediated mutation 3, Zhijian Chen
• MGI ID: MGI:7490024
• Synonyms: STING-deltaCTT
• Gene: Sting1 Location: Chr18:35866732-35873607 bp, - strand Genetic Position: Chr18, 19.23 cM, cytoband B3
• Alliance: Sting1^em3Zjc page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: A deltaCTT (TGA stop insertion) mutation is introduced just after sequences encoding amino acid 339 (exon 8) using CRISPR/cas9 methodologies (sgRNA CATTCGTCAGGAAGAAAAGG). Silent ATT to ATC (aa331) and CGT to CTA (aa332) mutations were introduced for genotyping purposes. (J:304755)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sting1 Mutation: 45 strains or lines available

References

• Original: J:304755 Yum S, et al., TBK1 recruitment to STING activates both IRF3 and NF-kappaB that mediate immune defense against tumors and viral infections. Proc Natl Acad Sci U S A. 2021 Apr 6;118(14):e2100225118
• All: 1 reference(s)