About   Help   FAQ
Sting1em2Zjc
Endonuclease-mediated Allele Detail
Summary
Symbol: Sting1em2Zjc
Name: stimulator of interferon response cGAMP interactor 1; endonuclease-mediated mutation 2, Zhijian Chen
MGI ID: MGI:7490022
Synonyms: STING-L373A
Gene: Sting1  Location: Chr18:35866732-35873607 bp, - strand  Genetic Position: Chr18, 19.23 cM, cytoband B3
Alliance: Sting1em2Zjc page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsA L373A (nucleotide change CTC to GCC) mutation is introduced to the TBK1 recruitment motif in exon 8 using CRISPR/cas9 methodologies (sgRNA AGATGAGGTCAGTGCGGAGT). A silent CTC to CTT mutation at amino acid 371 was introduced for genotyping purposes and to prevent Cas9/gRNA from targeting already edited sequences. (J:304755)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sting1 Mutation:  45 strains or lines available
References
Original:  J:304755 Yum S, et al., TBK1 recruitment to STING activates both IRF3 and NF-kappaB that mediate immune defense against tumors and viral infections. Proc Natl Acad Sci U S A. 2021 Apr 6;118(14):e2100225118
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory