Dock3^em1Msalx
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dock3^em1Msalx
• Name: dedicator of cyto-kinesis 3; endonuclease-mediated mutation 1, Matthew Alexander
• MGI ID: MGI:7489659
• Synonyms: Dock3^fl
• Gene: Dock3 Location: Chr9:106770024-107109108 bp, - strand Genetic Position: Chr9, 57.98 cM
• Alliance: Dock3^em1Msalx page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Guide RNAs (ACTGTCTAGCAGGTACAGTGGGG, GAAAAGTGATGGGGATCAATAGG, CACTGTCTAGCAGGTACAGTGGG, and AATAGGAAGTTGGGCTTAACTGG) are designed to insert loxP sites flanking exons 8-9. (J:341576)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dock3 Mutation: 98 strains or lines available

References

• Original: J:341576 Samani A, et al., DOCK3 regulates normal skeletal muscle regeneration and glucose metabolism. FASEB J. 2023 Oct;37(10):e23198
• All: 1 reference(s)