About   Help   FAQ
Rr56em1Axvi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr56em1Axvi
Name: regulatory region 56; endonuclease-mediated mutation 1, Axel Visel
MGI ID: MGI:7489595
Synonyms: B8
Gene: Rr56  Location: Chr19:25603664-25615164 bp  Genetic Position: Chr19, Syntenic
Alliance: Rr56em1Axvi page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe topologically associating domain (TAD) boundary region or insulator between Dmrt3 and Dmrt2, separating the Dmrt1/Dmrt3 TAD from the Dmrt2 TAD, was targeted with sgRNAs (targeting GAACAAGCAAGTGGGTATAAGGG, GAAAATACACTGTTTTGGGAGGG, AATCAGATATGAACGCACCAGGG and CGCACCAGGGAGCAGTATAGGGG) using CRISPR/Cas9 technology, resulting in an 11374 bp deletion (chr19:25603698-25615071(GRCm39)). (J:335096)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rr56 Mutation:  1 strain or line available
References
Original:  J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory