About   Help   FAQ
Rr51em1Axvi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr51em1Axvi
Name: regulatory region 51; endonuclease-mediated mutation 1, Axel Visel
MGI ID: MGI:7489587
Synonyms: B2
Gene: Rr51  Location: Chr5:120225075-120246315 bp  Genetic Position: Chr5, Syntenic
Alliance: Rr51em1Axvi page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe topologically associating domain (TAD) boundary region or insulator between Tbx5 and Rbm19, separating the Tbx5 TAD from the Lhx5 TAD, was targeted with sgRNAs (targeting AGATCTAAGACAGCCATGACAGG, CACTTTAGTAAAGTGTTGGGTGG, TTACACACCAATAATTGGGGGGG and CATAGGATACAGATATGTTGAGG) using CRISPR/Cas9 technology, resulting in a 21118 bp deletion (chr5:120225179-120246296 (GRCm39)). (J:335096)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rr51 Mutation:  1 strain or line available
References
Original:  J:335096 Rajderkar S, et al., Topologically associating domain boundaries are required for normal genome function. Commun Biol. 2023 Apr 20;6(1):435
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory