Rc3h1^em1Vihe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rc3h1^em1Vihe
• Name: RING CCCH (C3H) domains 1; endonuclease-mediated mutation 1, Vigo Heissmeyer
• MGI ID: MGI:7488434
• Synonyms: Rc3h1_L209Y
• Gene: Rc3h1 Location: Chr1:160733988-160802548 bp, + strand Genetic Position: Chr1, 69.75 cM
• Alliance: Rc3h1^em1Vihe page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Leucine codon 209 (CTG) was changed to tyrosine (TAT) (p.L209Y) using an sgRNA (targeting CAATGCAGAACCATCTTCTA) and an ssODN template with CRISPR/Cas9 technology. (J:324878)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rc3h1 Mutation: 41 strains or lines available

References

• Original: J:324878 Behrens G, et al., Disrupting Roquin-1 interaction with Regnase-1 induces autoimmunity and enhances antitumor responses. Nat Immunol. 2021 Dec;22(12):1563-1576
• All: 1 reference(s)