Del(Gm41148-Gm35360)14Zbch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(Gm41148-Gm35360)14Zbch
• Name: deletion, Chr 14, Zhen Bouman Chen
• MGI ID: MGI:7486772
• Synonyms: Leene KO
• Gene: Del(Gm41148-Gm35360)14Zbch Location: unknown Genetic Position: Chr14, Syntenic

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Del(Gm41148-Gm35360)14Zbch involves 2 genes/genome features (Gm41148, Gm35360) View all
• Mutation details: CRISPR/cas9 genome editing uses two guide RNAs (GCTGCGATCCGAACAGTGAG and TCGATCCTCATACATTTCAT) to delete a 47 kb region of mouse chromosome 14, including both Gm41148 and Gm35360, (mm39 chr14:48,019,230-;48,066,441) which corresponds to the human long intergenic non-protein coding RNA 520 locus (LINC00520). This region is also referred to as enhancer-associated long non-coding RNA (lncRNA) that enhances endothelial nitric oxide synthase expression (LEENE).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Del(Gm41148-Gm35360)14Zbch Mutation: 1 strain or line available

References

• Original: J:336135 Tang X, et al., Long noncoding RNA LEENE promotes angiogenesis and ischemic recovery in diabetes models. J Clin Invest. 2023 Feb 1;133(3)
• All: 2 reference(s)