About   Help   FAQ
Del(Gm41148-Gm35360)14Zbch
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(Gm41148-Gm35360)14Zbch
Name: deletion, Chr 14, Zhen Bouman Chen
MGI ID: MGI:7486772
Synonyms: Leene KO
Gene: Del(Gm41148-Gm35360)14Zbch  Location: unknown  Genetic Position: Chr14, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Intergenic deletion, Intragenic deletion
  Del(Gm41148-Gm35360)14Zbch involves 2 genes/genome features (Gm41148, Gm35360) View all
 
Mutation detailsCRISPR/cas9 genome editing uses two guide RNAs (GCTGCGATCCGAACAGTGAG and TCGATCCTCATACATTTCAT) to delete a 47 kb region of mouse chromosome 14, including both Gm41148 and Gm35360, (mm39 chr14:48,019,230-;48,066,441) which corresponds to the human long intergenic non-protein coding RNA 520 locus (LINC00520). This region is also referred to as enhancer-associated long non-coding RNA (lncRNA) that enhances endothelial nitric oxide synthase expression (LEENE).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Del(Gm41148-Gm35360)14Zbch Mutation:  1 strain or line available
References
Original:  J:336135 Tang X, et al., Long noncoding RNA LEENE promotes angiogenesis and ischemic recovery in diabetes models. J Clin Invest. 2023 Feb 1;133(3)
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory