About   Help   FAQ
D630039A03Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: D630039A03Rikem1(IMPC)J
Name: RIKEN cDNA D630039A03 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7486741
Gene: D630039A03Rik  Location: Chr4:57908483-57916297 bp, - strand  Genetic Position: Chr4, 31.87 cM
Alliance: D630039A03Rikem1(IMPC)J page
IMPC: D630039A03Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTATCGGTTCCACACACAT and TGGTTGCTCATTAAGCCAGC, which resulted in a 8032 bp deletion beginning at Chromosome 4 position 57,908,342 bp and ending after 57,916,373 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000438436 and ENSMUSE00000438430 (exons 1 and 2) and 5202 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any D630039A03Rik Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory