Trem2^{em3(TREM2)Aduci}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trem2^{em3(TREM2)Aduci}
• Name: triggering receptor expressed on myeloid cells 2; endonuclease-mediated mutation 3, Frank LaFerla
• MGI ID: MGI:7485952
• Synonyms: hTREM2-KI
• Gene: Trem2 Location: Chr17:48653429-48659304 bp, + strand Genetic Position: Chr17, 23.99 cM, cytoband C
• Alliance: Trem2^{em3(TREM2)Aduci} page

Mutation origin

• Strain of Origin: C57BL/6J-Trem2^{em2(TREM2*R47H)Aduci}/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Inserted expressed sequence)
• Mutation: Insertion
• Trem2^{em3(TREM2)Aduci} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  TREM2 (54209)

  Trem2

  (MGI:1913150)

• Mutation details: A guide RNA (GAAGCACTGGGGGAGGCACA) is designed to create a CAC to CGC mutation at position 47, restoring the R47H mutation to the wild-type derived H47R. ssODN repair template, gRNA, tracrRNA and CAS9 nuclease were introduced sequentially into the cytoplasm of C57BL/6-Trem2^{em2(TREM2*R47H)Aduci}-derived zygotes with well recognized pronuclei. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trem2 Mutation: 69 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)